Randomization of Genes by PCR Mutagenesis R. Craig Cadwell and Gerald F. Joyce Departments of Chemistry and Molecular Biology, The Scripps Research Institute, La Jolla, California 92037 A modified polymerase chain reac- tion (PCR) was developed to intro- duce random point mutations into cloned genes. The modifications were made to decrease the fidelity of Taq polymerase during DNA synthesis without significantly decreasing the level of amplification achieved in the PCR. The resulting PCR products can be cloned to produce random mu- tant libraries or transcribed directly if a T7 promoter is incorporated within the appropriate PCR primer. We used this method to mutagenize the gene that encodes the Tetrahyme- na ribozyme with a mutation rate of 0.66% -4- 0.13% (95% C.I.) per posi- tion per PCR, as determined by se- quence analysis. There are no strong preferences with respect to the type of base substitution. The number of mutations per DNA sequence follows a Poisson distribution and the muta- tions are randomly distributed throughout the amplified sequence. The technology of in vitro mutagene- sis allows one to probe structurally and functionally important regions within cloned genes. Random mutagenesis, coupled with a screening method, is es- pecially useful when functionally signif- icant positions are not well known. Sev- eral methods have been utilized to introduce random mutations into cloned genes, including chemical mu- tagenesis, (1-4) incorporation of nucle- otide analogues, (s-7) passage through bacteria that contain mutator genes/8) incorporation of randomized synthetic oligonucleotides, ~9-2~ and inaccurate copying by a polymerase. (21-28~ We find inaccurate copying by a polymerase to be the most attractive because of its sim- plicity and versatility. The fidelity of several DNA poly- merases has been measured, including the Klenow fragment of Escherichia coli DNA polymerase I, (29) T4 DNA poly- merase, (21~ modified T7 DNA polymerase (Sequenase)/3~ Taq DNA polymerase/313s) and Thermococcus litoralis (Vent) DNA polymerase/s6~ The fidelity of Taq poly- merase is the lowest and, when coupled to the amplificative power of the PCR, (37's8) makes Taq the best candidate for an in vitro mutagenesis procedure. The error rate of Taq is 0.001-0.02% per nucleotide per pass of the polymerase, depending upon reaction conditions/33'34~ For most purposes, this is insufficient to mutagenize a gene. Thus, modifications of either the reaction conditions or the polymerase itself are needed to achieve a substantial reduction of fidelity. There is a paper in the literature de- scribing a random mutagenesis proce- dure based on modification of the PCR/2s~ The fidelity of the PCR was re- duced by increasing the concentration of MgC12, adding MnCI~ to the reaction mixture, increasing and unbalancing the concentrations of the four dNTPs, in- creasing the concentration of Taq poly- merase, and increasing the extension time. Under the most error-prone condi- tion, the claimed error rate is 2% per po- sition per PCR, with an equal number of transitions and transversions. (2s) We tested the most error-prone condition re- ported by Leung et al. and obtained a mutation rate of 1.37% -+ 0.29% (95% C.I.). However, there were approxi- mately three times as many transitions as transversions, with a strong bias to- ward A ~ G and T ~ C transitions. This result prompted us to develop a new PCR mutagenesis protocol that does not have strong mutational bias and provides an overall error rate of 0.66% +- 0.13% (95% C.I.). MATERIALS AND METHODS Materials AmpliTaq DNA polymerase was pur- chased from Cetus; EcoRI, HindlII, and T4 polynucleotide kinase were from New England Biolabs; and T4 DNA ligase, Mo- MLV reverse transcriptase, and Seque- nase (version 2.0 kit) were from United States Biochemical. Buffered solutions of dNTPs and NTPs were purchased from Pharmacia. PCR primers, 5'-CTG- CAGAATTCTAATACGACTCACTATAGG- AGGGAAAAGTTATCAGGC-3' and 5'- CCAAGCTTGATCTCGAGTACT CCAAAA- CTAATC-3', and sequencing primers compatible with the pUC 18 plasmid, 5'- GTAAAACGACGGCCAGT-3', and 5'- CATGATTACGAATTCTA-3', were pur- chased from Operon Technologies and purified by polyacrylamide gel electro- phoresis and subsequent Sephadex chro- matography. [3SS]-(~-thio)-dATP (1000 Ci/mmole) was from Amersham. E. coli strain DH5~-F '~39) was obtained from 28 PCR Methods and Applications 2:28-339 by Cold Spring Harbor Laboratory ISSN 1054-9803/92 $3.00 Cold Spring Harbor Laboratory Press on November 13, 2025 - Published by genome.cshlp.org Downloaded from BRL. Parent plasmid pT7L-21 (4~ was pro- vided by T.R. Cech and cloning plasmid pUC 18 (AP2/AP5) (41) was provided by D.J. Decker. T7 RNA polymerase (4z) was prepared according to a modification of a procedure originally developed for SP6 RNA polymerase. (43) Preparation of Wild-type cDNA Plasmid pT7L-21 was transcribed as pre- viously described (41) and the resulting RNA was purified by polyacrylamide gel electrophoresis and subsequent Sepha- dex chromatography. The purified RNA was used to synthesize cDNA autocata- lytically by an isothermal amplification procedure. (44'4s) The amplification mix- ture contained 50 fmoles of RNA, 100 pmoles (each) PCR primers (see Materi- als), 10 mM MgCI2, 80 mM KOAc, 5 mM dithiothreitol, 50 mM Tris.HCl (pH 7.5), 2 mM (each) NTPs, 0.2 mM (each) dNTPs, 125 units of Mo-MLV reverse tran- scriptase, and 500 units of T7 RNA poly- merase in a 100-pA volume, which was incubated at 37~ for 3 hr. The RNA was digested by alkaline hydrolysis and the cDNA was purified by electrophoresis in a 5% polyacrylamide/8 M urea gel and subsequent affinity chromatography on Du Pont Nensorb. The yield of cDNA was quantitated spectrophotometrically. Polymerase Chain Reaction The standard reaction condition was compared to four mutagenic reaction conditions. All reaction mixtures con- tained 20 fmoles cDNA, 30 pmoles (each) PCR primers (see Materials), 50 mM KCl, 10 mM Tris.HCl (pH 8.3), and 0.01% gelatin in a 100-1~1 volume, which was cycled in an Ericomp thermal cycler for 30 cycles of 94~ for 1 min, 45~ for 1 min, and 72~ for 1 min. We did not employ a hot start procedure and did not carry out a prolonged extension reaction at the end of the last cycle. In addition to the above components, the standard re- action mixture contained 1.5 mM MgC12, 2.5 units of Taq polymerase, and 0.2 mM (each) dNTPs; the mutagenic reaction mixtures contained 7 mM MgCI2, 0.5 mM MnCI2, 5 units of Taq polymerase, and varying concentrations of the four dNTPs. MnC1 z must be added just prior to enzyme to prevent precipitation. PCR products were purified by chloroform/ isoamyl alcohol extraction and ethanol precipitation. Yields were estimated by running a small aliquot of the reaction mixture on a 2% agarose gel and visual- izing the ethidium bromide-stained products in comparison to known amounts of DNA. Cloning of PCR Products To facilitate restriction digestion, 2.5 I~g of PCR product DNA was concatenated in a concerted kination / ligation reac- tion, as previously described. (46) The en- zymes were heat-inactivated, the buffer was adjusted to 50 mM NaC1, and the DNA was digested with EcoRI and HindlII. The pUC18 (AP2/AP5) plasmid was similarly digested with EcoRI and HindlII and purified in 1% low-melting- point agarose gel. This vector contains two large deletions in the ribozyme gene that were PCR amplified, making it easy to distinguish vector religation products from vector that has incorporated the PCR fragment. The restriction-digested PCR fragment was incorporated into the target vector by ligation within low- melting point agarose. (47) The resulting plasmid DNA was used to transform competent DH5c~-F' cells, (48) which were grown on ampicillin-containing plates. Individual colonies were chosen at ran- dom and grown overnight in LB media. DNA was prepared by a boiling lysis miniprep protocol (49) and screened for the presence of insert by restriction di- gestion. DNA Sequencing DNAs were sequenced by the chain-ter- mination method (s~ using reciprocal primers that flank the cloned insert (see Materials). Sequencing reactions utilized modified T7 DNA polymerase (Seque- nase 2.0, USB) and [3sS]-(a-thio)-dATP and were analyzed by electrophoresis in a 6% polyacrylamide/8 M urea sequenc- ing gel. The 353 nucleotide positions that lie between the two sequencing primers were used for statistical analysis. RESULTS We first compared the standard PCR to the mutagenic PCR described by Leung and co-workers. (2s) The Leung protocol employs several modifications relative to the standard PCR that might be con- sidered mutagenic, including: (1) in- creased concentration of Taq poly- merase; (2) increased extension time; (3) increased concentration of MgC12; (4) addition of 0.5 mM MnC12 to the reaction mixture; and (5) increased (1 mM) con- centration of dGTP, dCTP, and dTTP to- gether with standard (0.2 mM) concen- tration of dATP. The last two modifications are expected to have the greatest impact on error rate. With the standard PCR, we obtained only I mutation in 3177 nucleotides that were sequenced. Thus, based on a one- tailed t-test, the error rate is <0.14% per position (95% C.I.). This error rate re- flects both mutations that occur during the PCR and mutations that occur dur- ing our preparative procedure. It is con- sistent with published values obtained under similar reaction conditions (34'38) and establishes a baseline for the present study. To obtain a more precise estimate of the error rate for the standard PCR, one must either sequence a very large number of nucleotides or, as has been done in the past, turn to in vivo selec- tion markers to screen a large population of DNA sequences for the presence of a single mutation. In general, direct se- quencing is impractical unless the muta- tion rate is above 0.2% per position per PCR. We tested a mutagenic PCR based on Leung's conditions and obtained an overall mutation rate of 1.37% +- 0.29% per position per PCR (95% C.I.; n = 6001). This is in reasonable agreement with the published value of 2%. (zs) How- ever, there was a substantial excess of A --~ G and T --~ C mutations, resulting in strong GC sequence bias (Table 1). The probability of mutation at an A or T po- sition was 2.14% -+ 0.51%, while the probability of mutation at a G or C po- sition was only 0.37% -+ 0.24% (95% C.I.). This bias can be understood in terms of the competition between dATP and dGTP for base-pairing at T positions along a DNA template (see Discussion). There may be special circumstances in which it is desirable to apply GC pressure while mutagenizing a gene. However, we sought to address the broader need for a mutagenesis technique that does not im- pose sequence bias. Previous studies concerning the effect of unbalanced concentrations of the four dNTPs on the fidelity of T4 DNA polymerase showed that the mutation rate could be increased only by increas- ing the dGTP/dATP ratio. (21) Predictably, this condition leads to an excess of A--~ G and T --~ C changes. The same limita- PCR Methods and Applications 29 Cold Spring Harbor Laboratory Press on November 13, 2025 - Published by genome.cshlp.org Downloaded from TABLE I Error Rate of the PCR Under Various Mutagenic Reaction Conditions a is- [dGTP] [dATP] Nucleotides Mutation rate AT--~GC Transitions mM mM sequenced (95% C.I.) GC---~AT Transversions 1.0 0.2 6,001 1.37 + _ 0.29% 10 2.7 0.2 0.2 16,591 0.66 + _ _ 0.13% 1 0.8 0.2 1.0 1,765 0.85 _ _ _ 0.43% 2 0.4 0.4 0.2 3,177 0.72 + 0.29% 4 3.2 aReaction conditions were as described in Materials and Methods, differing only in the concen- tration of dGTP and dATP. Mutation rate refers to the mean number of mutations per base pair per PCR (30 cycles). Frequencies of AT---~GC and GC---~AT mutations are corrected for base com- position of the mutated gene. tion might be expected to apply to other DNA polymerases. However, Taq poly- merase, which operates at higher tem- perature and has lower inherent fidelity compared to T4 DNA polymerase, turns out to be vulnerable to a variety of alter- ations in dNTP concentrations. Our preferred reaction condition for PCR mutagenesis employs 0.2 mM dGTP, 0.2 mM dATP, 1 mM dCTP, and 1 mM dTTP, but is otherwise identical to our formulation of the Leung condition de- scribed above. The preferred condition results in an overall mutation rate of 0.66% + 0.13% per position per PCR (95% C.I.; n = 16,591) and is free from GC or AT bias (Table 1). This data reflects the sum of two independent experi- ments, which were carried out using dif- ferent stock solutions and analyzed by separate cloning and sequencing proce- dures. The two independent mutation rates were 0.64% (n = 9884) and 0.69% (n = 6707), which do not differ signifi- cantly. Individual rates for various types of mutations of the form N ~ X and X --~ N (N = G,A,C,T; X ~ N) were tabulated for the two independent samples and, in all cases, found not to differ significantly at even the 90% confidence level. Thus, data from the two independent samples was pooled. The preferred reaction condition re- sults in no strong mutational bias (Fig. 1). There is a modest preference for T --~ X changes (X ~ T) and X ~ A changes (X A), both significant at the 99% confi- dence level. All other N ~ X and X ~ N changes cannot be said to differ at even the 90% confidence level. The frequency of insertions and deletions is <0.03% and <0.05%, respectively (one-tailed test, 95% C.I.). Two other reaction conditions were tested in an attempt to obtain a higher overall mutation rate while maintaining low mutational bias. The PCR was car- ried out in the presence of 0.2 mM dGTP, I mM dATP, 1 mM dCTP, and I mM dTTP, under reaction conditions otherwise identical to those above. This resulted in an error rate of 0.85% + _ _ 0.43% per posi- tion per PCR (95% C.I.; n = 1,765) (Table 1), but with strong bias in favor of A ~ X (X # A) and X ~ T changes (X # T). Finally, we tested a "compromise" con- A 1.5 1.0, frequency (%) 0.5- 0.0 G-bX A-~X C-~X T~X a 0.6 0.4- frequency i%) 0.2- 0.0 X~G X~A X~C X~T FIGURE 1 Frequency of various types of mu- tations under the preferred reaction condi- tion for PCR mutagenesis. (A) Mutations of the form N ~ X; (B), Mutations of the form X N; (N = G,A,C,T; X # N). Frequencies refer to the mean number of mutations per base pair per PCR (30 cycles), corrected for base composition of the mutagenized gene. Error bars correspond to 95% confidence interval. Dashed horizontal line indicates expected value based on an overall error rate of 0.66% per position per PCR. 10- # of clones 5- 0. i i i i i i 0 1 2 3 4 5 6 mutations / clone FIGURE 2 Comparison of observed number of mutations per DNA sequence (O) with ex- pected values based on a Poisson distribution (C)). A G-test for goodness of fit gave G = 3.26; when compared with the chi-square dis- tribution (6 d.f.) this indicates no significant difference between observed and expected values. dition using 0.4 mM dGTP, 0.2 mM dATP, 1 mM dCTP, and 1 mM dTTP. This re- sulted in an error rate of 0.72% + 0.29% per position per PCR (95% C.I.; n = 3,530) (Table 1), but with strong bias in favor of A ~ X changes (X # A). Returning to the preferred reaction condition, we tested whether there were any mutational "hotspots" or clustering of mutations within the DNA sequence. The number of mutations per DNA se- quence (109 mutations; 47 sequences) follows a Poisson distribution (Fig. 2). The mutations are randomly distributed throughout the amplified sequence, with no obvious nearest-neighbor effects (Fig. 3). The yield of DNA in the muta- genic PCR does not differ significantly from the yield in the standard PCR, as judged by agarose gel electrophoresis in the presence of ethidium bromide. DISCUSSION Much has been made of the importance of maximizing the fidelity of the PCR. (3~ Indeed, if the PCR is being used as a preparative procedure prior to subcloning, a low mutation rate is desir- able. However, there are instances in which a low-fidelity polymerization re- action would be useful, provided that it does not result in significant mutational bias. Recently, a number of in vitro selec- tive amplification techniques have been developed that depend on generation of an initial population of random vari- ants. (sl-64) Normally this is accom- plished by preparing degenerate oligode- JO PCR Methods and Applications Cold Spring Harbor Laboratory Press on November 13, 2025 - Published by genome.cshlp.org Downloaded from `1, `1, `1,`1, `1, l `1, 9 ..CAG GC[ATGCACCTGGTAG CTAGTCTTTAAACCAATAGATT G CATCG GTTTAAAAG G CAAGACCGTCAAATTG CG G GAAAG G ,1,, `1, `1, 4,4,,1, `1, `1, `1, `1, ,14, GGTCAACAGCCGTTCAGTACCAAGTCTCAGGGGAAACTTTG +++ +L + + AGATGGCCTTG CAAAGGGTATGGTAATAAGCTGACGGACAT `1, +4, 4, 114, 4, 14,4, 4,4, GGTCCTAACCACGCAGCCAAGTCCTAAGTCAACAGATCTTC TG]-TGATATGGATGCAGTTCACAGACTAAATGTCGGTCGGG `1,`1, `1, `1, `1,`1,`1, `1, 4,1 GAAGATGTATTCTTCTCATAAGATATAGTCGGACCTCTCCTT 4, `1,`1, `1, 4,14, ! `1, AATGGGAGCTAGCGGATGAAGTGATGCAACACTGGAGCCG `1, `1,`1, 1`1, `1,`1, `1, CTGG GAACTAATTTGTATGCG AAAGTATATTIGATTA". FIGURE 3 Distribution of mutations within the gene that was amplified. (Short arrow) One occurrence; (medium-length arrow) two occur- rences; (long arrow) three occurrences; no po- sition was mutated more than three times. The DNA strand having the same sense as the RNA transcript is shown. Boxed regions corre- spond to primer binding sites. oxynucleotides on an automated DNA synthesizer using nucleoside 3'-phos- phoramidite solutions that have been doped with a small percentage of each of the three incorrect mono- mers. (13'16'17'2~ The degenerate oligode- oxynucleotides are made double- stranded and ligated into the target gene. This method is time consuming and ex- pensive compared to a mutagenic PCR. Furthermore, it does not allow one to re- mutagenize those individuals that have been selected from the initial mutant population. The ability to iterate the mu- tation process while carrying out re- peated rounds of selective amplification greatly augments in vitro selection, in ef- fect converting it to an in vitro evolution procedure. (6s) More generally, PCR mutagenesis can be used to randomize any cloned gene for the purpose of generating mutant li- braries that can be screened for the ex- pression of some desirable phenotype. If the promoter sequence for T7 RNA poly- merase is included in the appropriate PCR primer, then the PCR products can be transcribed directly to produce a pop- ulation of mutant RNAs. If these RNAs contain an AUG start codon and main- tain proper codon usage, then they can be translated in vitro to produce a corre- sponding population of mutant pro- teins. In this study, we analyzed and subse- quently modified the PCR mutagenesis procedure of Leung and co-workers (zs~ to obtain a method for gene randomization that does not impose strong sequence bias. The Leung protocol, which em- ploys increased concentrations of dGTP, dCTP, and dTTP relative to dATP results in a substantial excess of A ~ G and T ---> C changes. This is likely due to forma- tion of G.T "wobble" pairs between in- coming dGTPs and T positions along the DNA template, favored by the increased dGTP : dATP ratio. Misincorporation of G opposite T accounts for the A ---> G changes, and copying of a misincorpo- rated G during the next pass of the poly- merase accounts for the T ~ C changes. Maintaining relatively low concentra- tions of both dATP and dGTP would make such events less favorable. Mass ac- tion would then be expected to favor the four transversion mutations. However, we found transitions and transversions to occur in a ratio of 0.75 : 1, which does not differ significantly from the unbi- ased value of 0.5 : 1 (90% confidence level). This suggests that there are other mutagenic forces operating in the PCR. Addition of 0.5 mM MnC12 to the re- action mixture is expected to have a sig- nificant mutagenic effect. MnC12 is known to be mutagenic for a variety of DNA polymerases (23> and data of Leung and co-workers suggest that this is the case for Taq polymerase as well. (2s> We have made no attempt to cooptimize the concentrations of MnC12 and the four dNTPs to achieve maximal error rate while maintaining minimal sequence bias. An obvious way to increase the overall error rate of the PCR would be to carry out more reaction cycles, although this increases the risk of obtaining PCR artifacts. (66~ Similarly one could carry out two consecutive PCRs, perhaps puri- fying the products of the first reaction by gel electrophoresis before proceeding with the second reaction. A more subtle way to increase the error rate of the PCR is to increase the concentration of Taq polymerase or to increase the extension time within each reaction cycle. These changes are expected to promote chain extension beyond positions of base mis- match. (67) Finally, it has been shown that the error rate of the PCR is en- hanced by increasing the concentration of MgC12, (3~ which presumably stabi- lizes noncomplementary pairs, and by increasing the pH, (3~ which may have an effect on the polymerase itself. The PCR mutagenesis procedure de- scribed in this study should be sufficient for most gene randomization purposes. We encourage others to seek further modifications of the reaction conditions that would result in a higher error rate without producing significant sequence bias. The types of manipulations dis- cussed above would be a reasonable place to start. Ultimately, though per- haps only after the three-dimensional structure of a thermostable DNA poly- merase is available, it may be possible to modify the polymerase itself to obtain a low-fidelity enzyme. ACKNOWLEDGMENTS We are grateful to Steven Reed for help- ful suggestions. This work was supported by NASA grant NAGW-1671 and NIH grant AI30882. REFERENCES 1. Chu, C.-T., D.S. Parris, R.A.F. Dixon, F.E. Farber, and P.A. Schaffer. 1979. Hydroxyl- amine mutagenesis of HSV DNA and DNA fragments: Introduction of mutations into selected regions of the viral genome. Virology 98: 168-181. 2. Shortle, D. and D. Botstein. 1983. Di- rected mutagenesis with sodium bisulfite. Methods Enzymol. 100: 457-468. 3. Myers, R.M., L.S. Lerman, and T. Maniatis. 1985. A general method for saturation mutagenesis of cloned DNA fragments. Science 229: 242-247. 4. Diaz, J.-J., D.D. Rhoads, and D.J. Roufa. 1991. PCR-mediated chemical mutagene- sis of cloned duplex DNAs. BioTechniques 11: 204-211. 5. Flavell, R.A., D.L. Sabo, E.F. Bandle, and C. Weissmann. 1974. Site-directed mutagen- esis: Generation of an extracistronic mu- tation in bacteriophage Q[3 RNA. J. Mol. Biol. 89: 255-272. 6. Mueller, W., H. Weber, F. Meyer, and C. Weissmann. 1978. Site-directed mutagen- esis in DNA: Generation of point muta- tions in cloned [3-globin complementary DNA at the positions corresponding to amino acids 121 to 123. J. MoL Biol. 124: 343-358. 7. Mott, J.E., J. van Arsdell, and T. Platt. 1984. Targeted mutagenesis in vitro: lac repressor mutations generated using AMV reverse transcriptase and dBrUTP. Nucleic Acids Res. 12: 4139-4152. 8. Cox, E.C. 1976. Bacterial mutator genes and the control of spontaneous mutation. Annu. Rev. Genet. 10: 135-156. 9. Matteucci, M.D. and H.L. Heyneker. 1983. Targeted random mutagenesis: The use of PCR Methods and Applications 31 Cold Spring Harbor Laboratory Press on November 13, 2025 - Published by genome.cshlp.org Downloaded from ambiguously synthesized oligonucle- otides to mutagenize sequences immedi- ately 5' of an ATG initiation codon. Nu- cleic Acids Res. 11: 3113-3121. 10. Hui, A., J. Hayflick, K. Dinkelspiel, and H.A. de Boer. 1984. Mutagenesis of the three bases preceding the start codon of the f3-galactosidase mRNA and its effect on translation in Escherichia coil EMBO J. 3: 623-629. 11. Dreher, T.W., J.J. Bujarski, and T.C. Hall. 1984. Mutant viral RNAs synthesized in vitro show altered aminoacylation and replicase activities. Nature 311: 171-175. 12. Wells, J.A., M. Vasser, and D.B. Powers. 1985. Cassette mutagenesis: An efficient method for generation of multiple muta- tions at defined sites. Gene 34: 315-323. 13. McNeil, J.B. and M. Smith. 1985. Saccha- romyces cerevisiae CYC1 mRNA 5'-end po- sitioning: Analysis by in vitro mutagenesis using synthetic duplexes with random mismatch base pairs. Mol. Cell. Biol. 5: 3545-3551. 14. Oliphant, A.R., A.L. Nussbaum, and K. Struhl. 1986. Cloning of random-se- quence oligodeoxynucleotides. Gene 44: 177-183. 15. Horwitz, M.S.Z. and L.A. Loeb. 1986. Pro- moters selected from random DNA se- quences. Proc. Natl. Acad. Sci. 83: 7405- 7409. 16. Hutchison, C.A., S.K. Nordeen, K. Vogt, and M.H. Edgell. 1986. A complete library of point substitution mutations in the glucocorticoid response element of mouse mammary tumor virus. Proc. Natl. Acad. Sci. 83: 710-714. 17. Derbyshire, K.M., J.J. Salvo, and N.D.F. Grindley. 1986. A simple and efficient procedure for saturation mutagenesis us- ing mixed oligodeoxynucleotides. Gene 46: 145-152. 18. Ner, S.S., D.B. Goodin, and M. Smith. 1988. A simple and efficient procedure for generating random point mutations and for codon replacements using mixed oli- gonucleotides. DNA 7: 127-134. 19. Reidhaar-Olson, J.F. and R.T. Sauer. 1988. Combinatorial cassette mutagenesis as a probe of the information content of pro- tein sequences. Science 241: 53-57. 20. Hermes, J.D., S.M. Parekh, S.C. Blacklow, H. K6ster, and J.R. Knowles. 1989. A reli- able method for random mutagenesis: the generation of mutant libraries using spiked oligodeoxynucleotide primers. Gene 84: 143-151. 21. Sinha, N.K. and M.D. Haimes. 1981. Mo- lecular mechanisms of substitution mu- tagenesis: an experimental test of the Watson-Crick and Topal-Fresco models of base mispairings. L Biol. Chem. 256: 10671-10683. 22. Zakour, R.A. and L.A. Loeb. 1982. Site-spe- cific mutagenesis by error-directed DNA synthesis. Nature 295: 708-710. 23. Beckman, R.A., A.S. Mildvan, and L.A. Loeb. 1985. On the fidelity of DNA repli- cation: Manganese mutagenesis in vitro. Biochemistry 24: 5810-5817. 24. Lehtovaara, P.M., A.K. Koivula, J. Barn- ford, and J.K.C. Knowles. 1988. A new method for random mutagenesis of com- plete genes: Enzymatic generation of mu- tant libraries in vitro. Prot. Eng. 2: 63-68. 25. Leung, D.W., E. Chen, and D.V. Goeddel. 1989. A method for random mutagenesis of a defined DNA segment using a modi- fied polymerase chain reaction. Technique 1: 11-15. 26. Holm, L., A.K. Koivula, P.M. Lehtovaara, A. Hemminki, and J.K.C. Knowles. 1990. Random mutagenesis used to probe the structure and function of Bacillus stearo- thermophilus. Prot. Eng. 3: 181-191. 27. Liao, X. and J.A. Wise. 1990. A simple high-efficiency method for random mu- tagenesis of cloned genes using forced nucleotide misincorporation. Gene 88: 107-111. 28. Zhou, Y., X. Zhang, and R.H. Ebright. 1991. Random mutagenesis of gene-sized DNA molecules by use of PCR with Taq DNA polymerase. Nucleic Acids Res. 19: 6052. 29. Keohavong, P. and W.G. Thilly. 1989. Fi- delity of DNA polymerases in DNA ampli- fication. Proc. Natl. Acad. Sci. 86: 9253- 9257. 30. Ling, L.L., P. Keohavong, C. Dias, and W.G. Thilly. 1991. Optimization of the polymerase chain reaction with regard to fidelity: Modified T7, Taq, and Vent poly- merases. PCR Methods Applic. 1: 63-69. 31. Tindall, K.R. and T.A. Kunkel. 1988. Fidel- ity of DNA Synthesis by the Thermus aquaticus DNA polymerase. Biochemistry 27: 6008-6013. 32. Ennis, P.D., J. Zemmour, R.D. Salter, and P. Parham. 1990. Rapid Cloning of HLA- A,B cDNA by using the polymerase chain reaction: Frequency and nature of errors produced in amplification. Proc. Natl. Acad. Sci. 87: 2833-2837. 33. Eckert, K.A. and T.A. Kunkel. 1990. High fidelity DNA synthesis by the Thermus aquaticus DNA polymerase. Nucleic Acids Res. 18: 3739-3744. 34. Eckert, K.A. and T.A. Kunkel. 1991. DNA polymerase fidelity and the polymerase chain reaction. PCR Methods Applic. 1: 17- 24. 35. Chen, J., A. Sahota, P.J. Stambrook, and J.A. Tischfield. 1991. Polymerase chain re- action amplification and sequence analy- sis of human mutant adenine phospho- ribosyltransferase genes: The nature and frequency of errors caused by Taq DNA polymerase. Mutat. Res. 249: 169-176. 36. Mattila, P., J. Korpela, T. Tenkanen, and K. PitRnen. 1991. Fidelity of DNA synthesis by the Thermococcus litoralis DNA poly- merase--an extremely heat stable enzyme with proofreading activity. Nucleic Acids Res. 19: 4967-4973. 37. Saiki, R.K., S. Scharf, F. Faloona, K.B. Mul- lis, G.T. Horn, H.A. Erlich, and N. Arn- helm. 1985. Enzymatic amplification of 13-globin genomic sequences and restric- tion site analysis for diagnosis of sickle cell anemia. Science 230: 1350-1354. 38. Saiki, R.K., D.H. Gelfand, S. Stoffel, S.J. Scharf, R. Higuchi, G.T. Horn, K.B. Mullis, and H.A. Erlich. 1988. Primer-directed en- zymatic amplificiation of DNA with a thermostable DNA polymerase. Science 239: 487-491. 39. Hanahan, D. 1983. Studies on transforma- tion of Escherichia coli with plasmids. J. IdoL Biol. 166: 557-580. 40.Zaug, A.J., C.A. Grosshans, and T.R. Cech. 1988. Sequence-specific endoribonu- clease activity of the Tetrahymena ri- bozyme: Enhanced cleavage of certain oligonucleotide substrates that form mis- matched ribozyme-substrate complexes. Biochemistry 2 7:8924-8931. 41. Beaudry, A.A. and G.F. Joyce. 1990. Mini- mum secondary structure requirements for catalytic activity of a self-splicing group I intron. Biochemistry 29: 6534- 6539. 42. Studier, F.W. and B.A. Moffatt. 1986. Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. J. MoL Biol. 189: 113-130. 43. Butler, E.T. and M.J. Chamberlin. 1982. Bacteriophage SP6-specific RNA poly- merase. I. Isolation and characterization of the enzyme. J. Biol. Chem. 257: 5772- 5778. 44. Guatelli, J.C., K.M. Whitfield, D.Y. Kwoh, K.J. Barringer, D.D. Richman, and T.R. Gingeras. 1990. Isothermal, in vitro am- plification of nucleic acids by a multien- zyme reaction modeled after retroviral replication. Proc. Natl. Acad. Sci. 87: 1874-1878. 45. Joyce, G.F. 1992. Selective amplification techniques for optimization of ribozyme function. In Antisense RNA and DNA (ed. J.A.H. Murray), pp. 353-372. Wiley-Liss, New York. 46. Kaufman, D.L. and G.A. Evans. 1990. Re- striction endonuclease cleavage at the ter- mini of PCR products. BioTechniques 9: 304-306. 47. Maniatis, T., E.F. Fritsch, andJ. Sambrook. 1989. Molecular cloning: A laboratory man- ual, pp. 1.72-1.73. Cold Spring Harbor Press, Cold Spring Harbor, New York. 48. Hanahan, D. 1985. Techniques for trans- formation of E. coli. In DNA cloning: A practical approach (ed. D.M. Glover), pp. 109-135. IRL Press, Oxford. 49. Holmes, D.S. and M. Quigley. 1981. A rapid boiling method for the preparation of bacterial plasmids. Anal Biochem. 114: 193-197. 50. Sanger, F., S. Nicklen, and A.R. Coulson. 32 PCR Methods and Applications Cold Spring Harbor Laboratory Press on November 13, 2025 - Published by genome.cshlp.org Downloaded from 1977. DNA sequencing with chain-termi- nating inhibitors. Proc. Natl. Acad. Sci. 74: 5463-5467. 51. Joyce, G.F. 1989. Amplification, mutation and selection of catalytic RNA. Gene 82: 83-87. 52. Robertson, D.L. and G.F. Joyce. 1990. Se- lection in vitro of an RNA enzyme that specifically cleaves single-stranded DNA. Nature 344: 467-468. 53. Scott, J.K. and G.P. Smith. 1990. Search- ing for peptide ligands with an epitope library. Science 249: 386--390. 54. Devlin, J.J., L.C. Panganiban, and P.E. Devlin. 1990. Random peptide libraries: A source of specific protein binding mole- cules. Science 249: 404-406. 55. Cwirla, S.E., E.A. Peters, R.W. Barrett, and W.J. Dower. 1990. Peptides on phage: A vast library of peptides for identifying ligands. Proc. Natl. Acad. Sci. 87: 6378- 6382. 56. Tuerk, C. and L. Gold. 1990. Systematic evolution of ligands by exponential en- richment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249: 505- 510. 57. Ellington, A.D. and J.W. Szostak. 1990. In vitro selection of RNA molecules that bind specific ligands. Nature 346: 818-822. 58. McCafferty, J., A.D. Griffiths, G. Winter, and D.J. Chiswell. 1990. Phage antibod- ies: Filamentous phage displaying anti- body variable domains. Nature 348: 552- 554. 59. Clackson, T., H.R. Hoogenboom, A.D. Griffiths, and G. Winter. 1991. Making antibody fragments using phage display libraries. Nature 352: 624-628. 60. Barbas, C.F., A.S. Kang, R.A. Lerner, and S.J. Benkovic. 1991. Assembly of combi- natorial antibody libraries on phage sur- faces: The gene III site. Proc. Natl. Acad. Sci. 88: 7978-7982. 61. Pei, D., H.D. Ulrich, and P.G. Schultz. 1991. A combinatorial approach toward DNA recognition. Science 253: 1408- 1411. 62. Bartel, D.P., M.L. Zapp, M.R. Green, and J.W. Szostak. 1991. HIV-1 Rev regulation involves recognition of non-Watson- Crick base pairs in viral RNA. Cell 67: 529-536. 63. Lowman, H.B., S.H. Bass, N. Simpson, and J.A. Wells. 1991. Selecting high-affinity binding proteins by monovalent phage display. Biochemistry 30: 10832-10838. 64. Bock, L.C., L.C. Griffin, J.A. Latham, E.H. Vermaas, andJ.J. Toole. 1992. Selection of single-stranded DNA molecules that bind and inhibit human thrombin. Nature 355: 564-566. 65. Beaudry, A.A. and G.F. Joyce. 1992. Di- rected evolution of an RNA enzyme. Sci- ence (in press). 66. Innis, M.A. and D.H. Gelfand. 1990. Op- timization of PCRs. In PCR protocols: A guide to methods and applications (eds. M.A. Innis, D.H. Gelfand, J.J. Sninsky, and T.J. White), pp. 3-12. Academic Press, San Diego. 67. Gelfand, D.H. and T.J. White. 1990. Ther- mostable DNA polymerases. In PCR proto- cols: A guide to methods and applications (eds. M.A. Innis, D.H. Gelfand, J.J. Snin- sky, and T.J. White), pp. 129-141. Aca- demic Press, San Diego. Received April 24, 1992; accepted in revised form June 8, 1992. PCR Methods and Applications 33 Cold Spring Harbor Laboratory Press on November 13, 2025 - Published by genome.cshlp.org Downloaded from 10.1101/gr.2.1.28 Access the most recent version at doi: 1992 2: 28-33 Genome Res. R C Cadwell and G F Joyce Randomization of genes by PCR mutagenesis. References http://genome.cshlp.org/content/2/1/28.full.html#ref-list-1 This article cites 61 articles, 19 of which can be accessed free at: License Service Email Alerting click here.
top right corner of the article or Receive free email alerts when new articles cite this article - sign up in the box at the https://genome.cshlp.org/subscriptions go to: Genome Research To subscribe to Copyright © Cold Spring Harbor Laboratory Press Cold Spring Harbor Laboratory Press on November 13, 2025 - Published by genome.cshlp.org Downloaded from